##################################### # # # Sobhani et al (2011) # # Raw pyrosequencing dataset # # contact : tap@embl.de # # # ##################################### 1) 16S rRNA gene PCR 16S rRNA gene primers used : V3f : tacgggaggcagcag V4r : attagataccctggtagtcc references : Wilson KH, Blitchington RB, Greene RC (1990) Amplification of bacterial 16S ribosomal DNA with polymerase chain reaction. J Clin Microbiol 28: 1942–1946. Lane DJ (1991) 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M, eds. Nucleic Acid Techniques in Bacterial Systematics.New York: John Wiley & Sons. 115–175. amplicon size: 439pb (E.coli 16S rRNA gene) 2) Run 454 Ti Design full run with 2 lanes and each lane there is 6 samples barcoded twice (1 DNA extraction, 1 PCR and 2 libraries preparation per sample).GsFLX key: TCAG Lane 1: Normal subjects (Lane1_Sobhani.tar.gz) 1stMID (*mid1.txt): 192-MID1 500-MID2 510-MID3 542-MID4 568-MID5 820-MID6 2ndMID (*mid2.txt): 192-MID7 500-MID8 510-MID9 542-MID10 568-MID11 820-MID12 Lane 2: Cancer subjects (Lane2_Sobhani.tar.gz) 1stMID (*mid1.txt): 268-MID1 414-MID2 551-MID3 552-MID4 722-MID5 825-MID6 2ndMID (*mid2.txt): 268-MID7 414-MID8 551-MID9 552-MID10 722-MID11 825-MID12 md5sum 91c9f7e452ce0bb226ffa99ec59d3042 Lane1_Sobhani.tar.gz 1b0bd4477854ccd587201084710f848c Lane2_Sobhani.tar.gz MID barcode sequence: MID-1 ACGAGTGCGT MID-2 ACGCTCGACA MID-3 AGACGCACTC MID-4 AGCACTGTAG MID-5 ATCAGACACG MID-6 ATATCGCGAG MID-7 CGTGTCTCTA MID-8 CTCGCGTGTC MID-9 TAGTATCAGC MID-10 TCTCTATGCG MID-11 TGATACGTCT MID-12 TACTGAGCTA Raw reads number per subject and per MID: Normal subjects Sample 1stMID 2ndMID 192 37064 50184 500 35007 43574 510 39752 39199 542 184454 49951 568 42771 34546 820 45196 40831 Cancer subjects Sample 1stMID 2ndMID 268 51989 30518 414 47789 47062 551 45894 46427 552 51800 45535 722 59517 44334 825 54104 43283 Undefined 10305 8129 example: 500-MID2 correspond to "sequence_500_mid1.txt" and 500-MID8 correspond to "sequence_500_mid2.txt".